• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    PCR detection method of Legionella pneumophila bacteria in environmental and/or clinical samples The present invention relates to a method for detecting Legionella pneumophila bacteria in environmental and/or clinical samples, preferably in air, by the polymerase chain reaction (PCR) technique without the need for prior culture. It is based on the detection of a specific region of the 16S rRNA gene of the bacterium, specifically in the section between the hypervariable regions V3 and V5, through the use of a pair of primers, of which the one that binds specifically to the V5 region has been designed for the first time in this invention. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2702117A1
    申请号:ES201830830
    申请日:2018-08-16
    公开日:2019-02-27
    发明作者:Parra Beatriz Sanchez；Hernandez Andres Nunez；Gomez Diego Alejandro Moreno
    申请人:Universidad Politecnica de Madrid；
    IPC主号:
    专利说明:

    [0001]
    [0002] METHOD OF PCR DETECTION OF BACTERIA Legionella pneumophila EN
    [0003] 5
    [0004] Technical sector of the invention
    [0005] The present invention is encompassed in the Biotechnology Industry, and more specifically belongs to the Environment and Health sector. It is encompassed in the field of the detection of pathogenic bacteria in environmental and clinical samples, being especially directed to the detection of Legionella pneumophila.
    [0006]
    [0007] BACKGROUND OF THE INVENTION
    [0008] Legionella is a genus of proteobacteria, Gram-negative, comprising 61 different species, of which 28 are associated with human diseases 15 (European Center for Disease Prevention and Control, European Legionnaires' Disease Surveillance Network (ELDSNet).) Operating procedures for the surveillance of travelassociated Legionnaires' disease in the EU / EEA Stockholm: ECDC (2017)).
    [0009]
    [0010] Normally, they cause Legionnaires' disease or legionellosis, which consists mainly of very high fever and pneumonia. But sometimes they can lead to a milder infection, similar to a flu called Pontiac fever.
    [0011]
    [0012] There are two species: Legionella longbeache and Legionella pneumophila that appear in all health records as the two species that cause the most infections in humans. Of the two, Legionella pneumophila is the one that causes most cases of legionellosis in Europe and in the United States (European Center for Disease Prevention and Control.) European Legionnaires' Disease Surveillance Network (ELDSNet) Operating procedures for the surveillance of travel-associated Legionnaires '30 disease in the EU / EEA Stockholm: ECDC (2017); Fields, BS, Benson, RF & Besser, RE Legionella and Legionnaires' Disease: 25 Years of Investigation, Microbiol Clin. Rev. 15, 506-526 ( 2002), Van Heijnsbergen, E. et al., Confirmed and potential sources of Legionella reviewed, Environ. Sci. Technol. 49, 4797-4815 (2015)).
    [0013] Currently legionellosis can be treated with antibiotics. However, the late detection of the presence of pathogenic Legionella in a patient can cause it to worsen rapidly and suffer respiratory failure, multiple organ system and eventually cause death (World Health Organization (WHO) .Legionellosis. (2017) .Available in: 5 http://www.who.int/mediacentre/factsheets/fs285/en/; Heath, CH, Grove, DI & Looke, DFM Delay in appropriate therapy of Legionella pneumophila associated with increased mortality Eur J Clin Microbiol Infect Dis 15, 286-290 (1996)).
    [0014]
    [0015] Among those most susceptible to infection by pathogenic Legionella are 10 those of advanced age, usually men, smokers, with transplants and / or immunosuppressed (Fields, BS, Benson, RF & Besser, RE Legionella and Legionnaires' Disease: 25 Years of Investigation, Microbiol Clin. Rev. 15, 506-526 (2002)). Legionella pneumophila causes outbreaks of infection each year, affecting a significant percentage of the human population.
    [0016] fifteen
    [0017] The most common way of contagion by Legionella is through the inhalation or aspiration of aerosols containing the pathogenic bacteria (European Center for Disease Prevention and Control.) European Legionnaires' Disease Surveillance Network (ELDSNet). Associated Legionnaires' 20 disease in the EU / EEA Stockholm: ECDC (2017); Allegra, S. et al., Characterization of aerosols containing Legionella generated upon nebulization, Sci. Rep. 6, 33998 (2016)). These aerosols usually come from devices and facilities that use water in their operation, such as ornamental fountains, air conditioning systems, cooling towers, swimming pools, spas, etc. (Van Heijnsbergen, E. et al.
    [0018] 25 Confirmed and potential sources of Legionella reviewed. Environ. Sci. Technol. 49, 4797 4815 (2015); Castillo, NE, Rajasekaran, A. & Ali, SK Legionnaires' Disease. A Review Infect. Dis. Clin. Pract 24, 248-253 (2016); Vaqué Rafart, J. & Martínez Gómez, X. Epidemiology of legionellosis. Med. Integr. 40, 271-281 (2002)).
    [0019]
    [0020] 30 The detection of the presence of Legionella pneumophila is one of the routine control procedures that are carried out in these human systems and devices that carry water. In these procedures, the detection of an infective dose of Legionella pneumophila can cause the complete installation to be closed so that it can be disinfected and cleaned before a new reopening and a new use.
    [0021] Currently, there are different described mechanisms that are used to detect and identify Legionella spp. in the water systems that produce aerosols and in possible infected patients. These mechanisms are based on the detection by culture, test of 5 antigens, serology, fluorescence and nucleic acids. The first two have been widely used for their high specificity (Fields, BS, Benson, RF & Besser, RE Legionella and Legionnaires' Disease: 25 Years of Investigation, Clinical Microbiol Rev. 15, 506-526 (2002)). Analyzes based on serology and fluorescence staining, although less specific, allow the bacteria to be detected over a long period of time, for example, in a patient already deceased. Finally, of all these methods, one that is based on nucleic acids, such as the PCR technique (Polymerase Chain Reaction) is one of the most used nowadays due to its speed and because it can be used with many types of clinical samples (sputum, BAL, biopsy, post mortem, etc.) and also environmental. In addition, the use of PCR is the method described by the "European Working 15 Group for Legionella Infections" (EWGLI) to be able to determine the serotype of a Legionella strain (Sequence-Based Typing (SBT); http: // bioinformatics.phe.org.uk/legionella/legionella_sbt/php/sbt_homepage.php).
    [0022]
    [0023] However, a limiting point for the methods of detection of Legionella 20 described above, is the need to have sufficient bacterial concentration.
    [0024] Therefore, these common techniques are often accompanied by a previous step of cultivation in specific media required to obtain sufficient microbial mass with which to carry out the analyzes (Fragou, K., Kokkinos, P., Gogos, C., Alamanos , Y. & Vantarakis, A. Prevalence of Legionella spp. In water systems of hospitals and hotels in 25 South Western Greece, J. Environ. Health Res. 22, 340-354 (2012); Tabatabaei, M., Hemati , Z., Moezzi, M. & Azimzadeh, N. Isolation and identification of Legionella spp., From different aquatic sources in South-West of Iran by molecular and culture methods, Mol. Biol. Res. Commun. 5, 215-223 ( 2016)).
    [0025]
    [0026] 30 The need to perform a bacterial culture for Legionella spp. can present a problem in those samples where their viability is affected, such as some environmental samples such as air samples, which can also present a large amount of very diverse bacterial load and where pathogens such as Legionella pneumophila are represented in a smaller proportion being 35 difficult to detect (Fronczek, CF & Yoon, JY Biosensors for Monitoring Airborne Pathogens. J. Lab. Autom. 20, 390-410 (2015); Núñez, A. et al. Monitoring of airborne biological particles in outdoor atmosphere. Part 1: Importance, variability and ratios. Int. Microbiol. 19, 1-13 (2016)).
    [0027]
    [0028] In view of the above considerations on the current state of the technical field of the rapid and efficient detection of pathogenic bacteria, the present invention proposes a method that allows to detect the bacterium Legionella pneumophila in non-cultivable samples (or without the need to be cultivated), with low concentration of DNA (deoxyribonucleic acid) and that come from the main transmission route of the bacteria: the 10 aerosols.
    [0029]
    [0030] Description of the invention
    [0031] The present invention relates to a rapid method (meaning quick as a time equal to or less than 24 h) of detection of Legionella pneumophila in environmental and / or clinical samples, preferably of air, which is based on the PCR technique and not You need to carry out a previous culture of the bacteria.
    [0032]
    [0033] The fundamental basis of this method is a PCR nested from DNA extracted directly from the samples, without going through an initial step of microbiological culture. twenty
    [0034] From now on, we will refer to this as the method of invention.
    [0035]
    [0036] The present invention thus relates to a method of detecting Legionella pneumophila in a sample, without prior cultivation of said sample, comprising:
    [0037] 25 - performing a first polymerase chain reaction (PCR) on the sample using a pair of primers (primers) that amplify a region of the 16S bacterial rRNA and increase the number of copies of a gene region containing the sequence of interest; Y
    [0038] - carrying out a second nested PCR, using a pair of 30 specific primers of the Legionella pneumophila species that bind to a region of the 16S rRNA gene amplified in the first PCR. One of the two primers is the so-called VR5 comprising at least the following sequence: CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    [0039] This second reaction is one that specifically detects a region belonging to the target bacterial species of the present method of invention.
    [0040]
    [0041] Unless otherwise specified herein, all described nucleotide sequences, such as the above primer sequence, are located between the 5'- and -3 'ends. Thus, for example, the primer sequence CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1) can also be written as 5'-CCACTAATTATTTTCATATAACCAAC-3 '(SEQ ID No. 1).
    [0042]
    [0043] The first VR5 is complementary to positions 831-856 of the 16S rRNA gene and corresponds to the first reverse (or antisense primer), and has been specifically designed for the method of the invention (although the last five nucleotides match the initials of a primer described by Jonas, D., Rosenbaum, A., Weyrich, S. & Bhakdi, S. Enzyme-Linked Immunoassay for Detection of PCR-Amplified DNA of 15 Legionellae in Bronchoalveolar Fluid, J. Clin Microbio !. , 1247-1252 (1995).
    [0044] Preferably, the VR5 primer consists of the sequence:
    [0045] CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    [0046]
    [0047] In a particular case, the homologous sequence of this VR5 primer differs by no more than 4 nucleotide substitutions. In another particular case, the homologous sequence differs by no more than 3 nucleotide substitutions. In another particular case, the homologous sequence differs in no more than 2 nucleotide substitutions. In another particular case, the homologous sequence differs by no more than 1 nucleotide substitution.
    [0048] 25
    [0049] In short, the method of invention allows to detect the presence of Legionella pneumophila through two consecutive amplifications or nested (in English, nested) of a region of the gene 16S rRNA of the bacterial species of interest, Legionella pneumophila , in a sample that can be environmental and / or clinical.
    [0050] 30
    [0051] The novelty of the method of invention is its high sensitivity in the detection of the target bacterium, which makes it possible to apply it preferably to air samples that have at least a low concentration of DNA (deoxyribonucleic acid) total of approximately 10 pg / pL, equivalent to approximately 12 pg of DNA per m3 of air. As the origin of this genetic material does not come from a single organism but resulting from the mixing of many biological particles (bacteria, fungi, pollen, archaea, etc.) that are present in the air, the concentration of Legionella pneumophila is therefore much lower. Therefore, this method of invention shows a high sensitivity for the detection of Legionella pneumophila, eluding the presence of the rest of biological particles in the sample of analysis.
    [0052]
    [0053] Thus, in a preferred embodiment, the method is applied to an air sample. Thus, this preferred embodiment of the method of invention is applied to DNA samples from biological particles present in environmental samples of air, not cultivable or that have not been previously cultivated, but have been obtained for example and not exclusively, with a particle collector such as the "Burkard 7 Day Recording Volumetric Spore Sampler" (from Burkard Scientific) or with membrane filters (nitrocellulose, Teflon, PTFE or similar) by aspiration.
    [0054]
    [0055] The method of this invention also stands out for the speed with which it can be carried out, because once the DNA to be analyzed has been extracted, the two PCR reactions can be carried out in a single day, including the visualization of the results obtained. Said visualization can be done by usual techniques known in the scientific field, such as, for example, by the non-exclusive use of intercalating agents 20 such as, for example, ethidium bromide or SyBr safe, and then observed through an ultraviolet lamp. or a transilluminator. All these elements are available and are part of many laboratories.
    [0056]
    [0057] The detection of Legionella pneumophila is carried out in comparison with a positive control sample and a negative one. These control samples may be, but are not limited to, DNA from a bacterial strain of the same target species (for the positive control) or another species of the same Legionella genus (for the negative control).
    [0058]
    [0059] If in the second PCR, amplification of the size of ~ 400 bp (pairs of 30 bases) is obtained, it can be considered that the pathogenic bacterium Legionella pneumophila is present in the sample analyzed.
    [0060]
    [0061] This method of invention does not require that the amplicon obtained in the second PCR reaction be sequenced, due to the specificity of the method. However, in a preferred embodiment it is advisable to purify the DNA of said amplicon (e.g. with a commercial purification kit, following the manufacturer's instructions) and sequencing by the "Sanger" method. The sequence obtained, if analyzed with the Blastn tool (Basic Local Alignment Search Tool of Nucleotide) of the NCBI (National Center for Biotechnology Information), confirms the result of the presence of Legionella 5 pneumophila in the sample.
    [0062]
    [0063] Preferably, the primer pair of the first PCR is composed of two universal primers 5F and 907R (Lane, DJ 16S / 23S rRNA sequencing Nucleic acid techniques in bacterial systematics John Wiley and Sons:.. New York, NY pp.. 115-175 10 (1991)), said primers presenting the following sequence:
    [0064] or 5F: TGGAGATTTGATCCTGGCTCAG (SEQ ID No. 2), or a homologous sequence; Y
    [0065] or 907R: CCGTCAATTCCTTTGAGTTT (SEQ ID No. 3), or a homologous sequence.
    [0066] fifteen
    [0067] Most preferably, these two primers amplify a region of approximately 900 bp of the bacterial 16S rRNA gene.
    [0068]
    [0069] Also preferably, in the second PCR, the primer that is used in conjunction with the VR5 primer is a primer that is designated VR3, also specific to the Legionella pneumophila species , which comprises at least the following sequence:
    [0070] GGGTT GAT AGGTT AAGAGCTGATT AAC (SEQ ID No. 4), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    [0071] 25
    [0072] In a preferred embodiment, the VR3 primer consists of the sequence:
    [0073] GGGTT GAT AGGTT AAGAGCTGATT AAC (SEQ ID No. 4), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    [0074] 30
    [0075] In a particular case, the homologous sequence of the VR3 primer differs by no more than 4 nucleotide substitutions. In another particular case, the homologous sequence differs by no more than 3 nucleotide substitutions. In another particular case, the homologous sequence differs in no more than 2 nucleotide substitutions. In another particular case, the homologous sequence differs by no more than 1 nucleotide substitution.
    [0076] Thus, in this particular case of the invention, the second PCR is carried out with two primers that bind to an amplified region corresponding to the hypervariable regions V3 and V5 of the 16S rRNA gene. In this particular case, the fragment that amplifies this second pair of primers has 424 bp. The first VR3 is initially positioned at base 439 and reaches 477 and corresponds to the first forward (or sense primer) of the reaction. Its complete sequence or with a difference of one or two nucleotides has been previously described (ES2395798A1, CN105219847A, US2007042422A1, CN105255876A, Jonas, D., Rosenbaum, A., Weyrich, S. & Bhakdi, S.
    [0077] 10 Enzyme-Linked Immunoassay for Detection of PCR-Amplified DNA of Legionellae in Bronchoalveolar Fluid. J. Clin. Microbe!. 33, 1247-1252 (1995)).
    [0078]
    [0079] In the most preferred embodiment of the method of detection of Legionella pneumophila, this method comprises:
    [0080] 15 - Carry out a first Polymerase Chain Reaction (PCR) on the sample, using a pair of universal primers 5F and 907R (Lane, DJ 16S / 23S rRNA sequencing.) Nucleic acid techniques in bacterial systematics. Wiley and Sons: New York, NY, pp. 115-175 (1991)), to amplify a region of approximately 900 bp of the bacterial 16S rRNA gene and increase the copy number of a gene region containing the sequence of interest, said primers have the following sequence:
    [0081] 5F: TGGAGATTTGATCCTGGCTCAG (SEQ ID No.2); Y
    [0082] 907R: CCGTCAATTCCTTTGAGTTT (SEQ ID No.3); Y
    [0083] - carry out a second nested PCR, by means of a pair of primers 25 called VR3 and VR5 specific for the Legionella pneumophila species , which bind to an amplified region in the first PCR and correspond to the hypervariable regions V3 and V5 of the 16S gene rRNA, said primers comprising at least the following sequence:
    [0084] or GGGTT GAT AGGTT AAGAGCTGATT AAC (SEQ ID No. 4), or a homologous sequence with any substitution in the described sequence of 5 bases or less in any position, independently of each other;
    [0085] or CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1), or a homologous sequence with any substitution in the described sequence of 5 bases or 35 less in any position, independently of each other.
    [0086] A second object of the present invention is a primer (VR5) or primer for PCR which comprises the following nucleotide sequence:
    [0087] CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    [0088]
    [0089] Preferably, the VR5 primer for PCR consists of the sequence:
    [0090] CCACT AATT ATTTT CATAT AACCAAC (SEQ ID No. 1), or a homologous sequence that differs in no more than 5 nucleotide substitutions.
    [0091] 10
    [0092] In a particular case, the homologous sequence of the VR5 primer differs by no more than 4 nucleotide substitutions. In another particular case, the homologous sequence differs by no more than 3 nucleotide substitutions. In another particular case, the homologous sequence differs in no more than 2 nucleotide substitutions. In another particular case, the homologous sequence differs by no more than 1 nucleotide substitution.
    [0093]
    [0094] This first VR5 is complementary to positions 831-856, and is specific to the Legionella pneumophila species . In a particular case of the primer, the homologous sequence differs by no more than 4 nucleotide substitutions. In another particular case, the homologous sequence differs by no more than 3 nucleotide substitutions. In another particular case, the homologous sequence differs in no more than 2 nucleotide substitutions. In another particular case, the homologous sequence differs by no more than 1 nucleotide substitution.
    [0095]
    [0096] Another object of the present invention is the use of the VR5 primer in a PCR for the detection of a pathogenic bacterium, which is Legionella pneumophila, being in a particular case a second PCR nested in a detection method comprising two PCR amplification, preferably of amplification of the bacterial 16S rRNA gene.
    [0097] Another object of the present invention is a kit for the detection of a pathogenic bacterium, comprising a plurality of primers, wherein at least one of them is a VR5 primer comprising at least the following sequence:
    [0098] CCACT AATT ATTTT CATAT AACCAAC (SEQ ID No. 1), or a homologous sequence that differs in no more than 5 nucleotide substitutions.
    [0099] 35
    [0100] In a preferred case, the kit comprises a VR5 primer that consists specifically of the sequence:
    [0101] CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    [0102] 5
    [0103] Preferably, this kit is for the detection of Legionella pneumophila.
    [0104]
    [0105] In a particular embodiment of the kit, it comprises at least one pair of primers, wherein in addition to the primer VR5 it also comprises the VR3 primer described above, which amplify the hypervariable regions of the 16S rRNA: V3-V5 gene.
    [0106]
    [0107] The term "pathogenic bacteria" refers to bacteria that can cause disease in a subject, preferably a human being This invention is directed specifically to the pathogenic bacterium Legionella pneumophila.
    [0108] fifteen
    [0109] Legionella pneumophila is understood to be a bacterium of the Legionella genus that, in natural situations, lives as a parasite in amoebae or other ciliated protozoa of aquatic environments (Fields, BS The molecular ecology of legionellae, Trends Microbiol., 4, 286-290 (1996)), resists a wide range of temperatures (20-50 ° C) (Katz, SM & 20 Hammel, JM The effect of drying, heat, and pH on the survival of Legionella pneumophila, Ann. Clin. Lab. Sci. 17, 150-156 (1987)) and is capable of causing infection in a living organism causing Pontiac fever, or even legionellosis.
    [0110]
    [0111] The term "nucleic acid" (or nucleotide sequence, or polynucleotide) refers to a polymeric form of nucleotides of any length, both ribonucleotides and deoxyribonucleotides, preferably the isolated nucleic acid is deoxyribonucleic acid (DNA). any method or technique known to the person skilled in the art Nucleic acid can also refer to ribonucleic acid (RNA).
    [0112] 30
    [0113] The term "sample" refers to any type of solid sample, gaseous, liquid or in the form of arerosol.The term "air sample" refers to any sample of air, such as, for example, air from an urban area, rural area. or even the interior of a building, preferably a sample of air that transports water drops and that is collected outside where it can be breathed by any human. The invention is therefore useful for controlling the quality of an air sample, that is, useful for knowing if a sample of air contains pathogenic bacteria such as Legionella pneumophila.
    [0114]
    [0115] The term "aerosol" is a set of microscopic particles, solid or liquid, which are suspended in a gas In the context of the present invention, an aerosol is a liquid particle, usually water, which in turn contains the pathogenic bacteria, and that is transported by suspension in the air.
    [0116]
    [0117] In the method of the invention, the presence of the 16S rRNA gene is detected by an initial PCR followed (or coupled) to another secondary PCR. Process that is also known as nested PCR. The detection is preferably performed on the DNA of said gene.
    [0118] The term "nested PCR" (or nested) refers to the PCR that is carried out subsequently to another PCR in which an amplification product has been produced, where in this new amplification the amplified product is used as template DNA in the first and amplification is performed using primers (or primers) that are located within the first amplified sequence.
    [0119]
    [0120] The term "primer" (or primer) refers to a nucleotide sequence of variable size that is complementary to a fragment of the sequence of a gene (template DNA) and that is used in a PCR reaction to amplify a sequence nucleotide
    [0121]
    [0122] 25 The 16S rRNA gene (also called 16S, 16S ribosomal, r16S) is a component of the 30S subunit of the prokaryotic ribosome. The 16S rRNA gene in the present invention refers to the 16S rRNA of Legionella spp.
    [0123]
    [0124] In the present method of invention, examples of primers that amplify the gene described in the invention are provided. The nucleotide sequences of these primers described in the present invention may be susceptible to variations. These variations could be used to detect another microorganism (s) of interest for human health, present / s in an environmental sample, preferably of air. For this reason, a preferred embodiment of the method of the invention relates to the detection of pathogenic bacteria. Within the scope of the present invention, when defines a primer by its characterizing nucleotide sequence, the definition also includes homologous sequences with a certain degree of variability with respect to the defined sequence, usually not differing in more than 5 nucleotide substitutions.
    [0125] 5
    [0126] The term "hypervariable region" refers to any of the 9 gene sections of the 16S rRNA gene that the bacteria possess, they are distributed among other highly conserved parts of the gene in the different bacterial species that exist, these hypervariable regions allow us to distinguish bacterial species of another, provided that their genomes are sequenced In the present invention the hypervariable regions comprised between V3 and V5 are used to distinguish Legionella pneumophila from other bacteria.
    [0127]
    [0128] The term "amplicon" (or band) refers to the amplified product of a PCR reaction having the expected size of base pairs, according to the gene regions to which the primers bind.
    [0129]
    [0130] The term "base pairs" (bp) refers to the binding that occurs between two nucleotides that make up a nucleic acid, through hydrogen bonds.
    [0131] twenty
    [0132] Brief description of the figures
    [0133]
    [0134] Figure 1: Schematic and non-limiting representation of the steps used to detect Legionella pneumophila according to the method of the present invention. Two consecutive or nested PCR reactions (1 and 2) are the basis of the method of invention:
    [0135] the first (1) is designed to amplify a partial region of the 16S rRNA (4) gene from DNA samples obtained from outside air (3), while the second (2) uses specific primers or primers to detect Legionella pneumophila ( 5) from the DNA amplified in the first PCR, of which, the first VR5 has been specifically designed in this method of invention.
    [0136]
    [0137] Figure 2: Detection of Legionella pneumophila in the DNA extracted from urban air samples, according to the Exemplary embodiment. Bands of amplified DNA of the 16S rRNA gene in the section between the hypervariable regions V3 and V5. The pair of primers "VR" (VR3 and VR5) was used to detect the presence of Legionella pneumophila but also the pair of primers "LEG" (LEG 448 and LEG 858) that allows to determine the presence or absence of the genus Legionella spp. The specific bands of Legionella pneumophila appear in the positive control sample of Legionella pneumophila (L.pn) and in two of the samples collected (No. 1 and 2). In 5 of these samples, the band of the genus Legionella spp. Also appears, as in the control with Legionella jordanis (L.jo) and the sample collected No. 3. On the contrary, no amplification is observed using the pairs of primers "LEG" or "VR" in samples with absence of Legionella spp. as the control with the bacterium Escherichia coli (E.co).
    [0138] 10
    [0139] Occasionally, remains of the ~ 900 bp band appear, resulting from the first PCR of the method of invention where the universal primers 5F and 907R are used. M, molecular weight marker (100 bp).
    [0140]
    [0141] 15 Examples
    [0142] Example 1: Detection of Legionella pneumophila in air samples by the method of the present invention.
    [0143] The following example illustrates a real application of the method of invention carried out with the method of the present invention.
    [0144] twenty
    [0145] Materials:
    [0146] - Samples to study:
    [0147] 12 air samples collected during the period of one year have been used, covering the four annual seasons: spring, summer, autumn and winter.
    [0148] 25
    [0149] The samples were collected following the protocol described in Núñez et al. (Núñez, A. et al., Validation of the Hirst-type spore trap for simultaneous monitoring of prokaryotic and eukaryotic biodiversities in urban air samples by next-generation sequencing, Appl. Environ. Microbiol. 83, e00472-17 (2017)) and then the 16S rRNA gene (V3-V4 regions) was used to sequence the mass using an Illumina MiSeq platform (2x300 reads). Said sequencing detected the 12 samples with the presence of Legionella spp. that have been used in this trial.
    [0150]
    [0151] Table 1 shows the DNA concentration of each of these samples, reflecting the small amount of which is split for later detection of Legionella. pneumophila. The DNA concentration of the air samples was determined by a PicoGreen assay.
    [0152]
    [0153] Table 1: Information of the samples used in the example of embodiment of the method of invention
    [0154]
    [0155] Samples Season of the year
    [0156] sampling Concentration (ng / pL) at 1 Winter 0.01 2 Spring 0.12 3 Spring 0.07 4 Summer 0.27 5 Autumn 0.12 6 Autumn 0.03 7 Autumn 0.03 8 Autumn 0.05 9 Autumn 0.04 10 Winter 0.28 11 Spring 0.26 12 Spring 0.17
    [0157] - Control samples:
    [0158] As control samples, the DNA extracted from the bacterium Escherichia coli CECT, 516 (Spanish Type Culture Collection), and the genomic DNA of the commercial strains 10 Legionella pneumophila DMSZ, 7513 (German Collection of Microorganisms and Cell Cultures, MinervaBiolabs), were used. and Legionella jordanis NCTC, 11533 (National Collection of Type Cultures, MinervaBiolabs).
    [0159]
    [0160] - Primers used in the nested PCR of the method of invention :
    [0161] 15 Two pairs of primers were used , each for a PCR. The first is composed of two universal primers (5F, TGGAGATTTGATCCTGGCTCAG (SEQ ID No. 2) and 907R, CCGTCAATTCCTTTGAGTTT (SEQ ID No. 3)) (Lane, DJ
    [0162] 16S / 23S rRNA sequencing. Nucleic acid techniques in bacterial systematics. John Wiley and Sons: New York, NY. pp. 115-175 (1991)) and used to carry out the first PCR reaction by amplifying a 900 bp fragment in a region of the 16S rRNA gene.
    [0163] The second pair of primers is used to specifically detect the Legionella pneumophila species . These primers, denominated like "VR" are: VR3: GGGTTGATAGGTTAAGAGCTGATTAAC (SEQ ID No. 4) initially positioned in the base 439 and arriving until the 477 and the first VR5: CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1), complementary to positions 831-856. The fragment that amplifies this second pair of primers has 424 bp.
    [0164]
    [0165] The two primer pairs were purchased from Roche Diagnostics S.L.
    [0166] 5
    [0167] Methods:
    [0168] First PCR: the increase in the number of copies of the gene region that is used as a template for the second PCR, was done by adding (for a final reaction volume of 25 pL, although it can be adapted to other volumes) 2 pL (20- 560 pg) of the extracted DNA 10 of the air samples and 1.25 U of Taq polymerase. The reaction was carried out following the protocols known to any expert in the field. The Taq polymerase, buffer and dNTPs (mixture of deoxyribonucleoside triphosphates) were from Promega (USA).
    [0169]
    [0170] The tube with all the elements of the final PCR mixture was introduced into the thermal cycler to carry out the first amplification under the following conditions:
    [0171] - Initial heating step at 95 ° C, 5 minutes.
    [0172] - Second step consisting of 35 cycles consisting, each, of:
    [0173] - Denaturation at 95 ° C, 30 seconds.
    [0174] - Annealing or Annealing at 55 ° C, 1 minute.
    [0175] 20 - Extension at 72 ° C, 1 minute.
    [0176] - Final extension 72 ° C, 10 minutes.
    [0177]
    [0178] Second PCR: 2 pL of the amplification product of the first PCR was taken to be used as a template in this second reaction. To the reaction mixture were added 1.25 U of Taq polymerase and the rest of the components, following the protocols known to any expert in the field. The Taq polymerase, buffer and dNTPs were from Promega (USA).
    [0179]
    [0180] The tube with all the elements of the final PCR mixture was introduced into the thermal cycler to carry out the second amplification under the following conditions:
    [0181] - Initial heating step at 95 ° C, 5 minutes.
    [0182] - Second step consisting of 35 cycles consisting, each, of:
    [0183] - Denaturation at 95 ° C, 30 seconds.
    [0184] - Annealing or Annealing at 55 ° C, 1 minute.
    [0185] 35 - Extension at 72 ° C, 1 minute.
    [0186] - Final extension 72 ° C, 10 minutes.
    [0187]
    [0188] Visualization of the results:
    [0189] For the visualization of the results, 1.5% agarose gel with ethidium bromide or SyBr safe was used. 15 pL of the PCR product was loaded together with 5 pL of loading buffer in each well of the gel. From the 100-bp BenchTop marker (Promega) 6 pL were loaded together with 6 pL loading buffer. Electrophoresis was performed at 100 V for 50 minutes. Finally, the results were visualized in a transilluminator.
    [0190] These results are shown in Figure 2.
    [0191] 10
    [0192] In all the controls used, as in all collected air samples, an amplification of 900 bp was obtained in the first PCR. However, in the second PCR, amplification of 424 bp was obtained in the positive control (Legionella pneumophila DMSZ, 7513) and in 7 of the 12 samples analyzed.
    [0193] fifteen
    [0194] The remaining 5 samples were positive for Legionella spp., But not for L. pneumophila species . This was verified with a third PCR reaction in which primers previously known in the literature were already described as "LEG" and used to detect this bacterial genus (Yamamoto, H., Hashimoto, Y. & Ezaki, T.
    [0195] 20 Comparison of detection methods for Legionella species in environmental water by colony isolation, fluorescent antibody staining, and polymerase chain reaction. Immunol. 37, 617 622 (1993)). The nucleotide sequence of each of the LEG primers is:
    [0196] - LEG 448 (Primerforward): GAGGGTTGATAGGTTAAGAGC (SEQ ID No.5). - LEG 858 (Primerreverse): GTCAACTTATCGCGTTTGCT (SEQ ID No.6). 25
    [0197] The 12 samples turned out to be positive for Legionella spp. This extra check allows the method of invention to be defined as very specific for Legionella pneumophila .
    权利要求:
    Claims (1)
    [0001]
    1. A method of detecting Legionella pneumophila in a sample, without previous culture of said sample, comprising:
    5 - carry out a first Polymerase Chain Reaction (PCR) on the sample, using a pair of primers that amplify a region of the bacterial 16S rRNA gene; Y
    - carry out a second nested PCR, using a pair of specific primers of the Legionella pneumophila species that bind to a region of the 16S rRNA gene amplified in the first PCR, where one of the two primers comprises at least the following sequence:
    CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    2. The method of the preceding claim, wherein the sample is environmental and / or clinical.
    3. The method according to any one of claims 1 or 2, wherein the sample is an air sample.
    4. The method according to any one of the preceding claims, wherein the pair of primers of the first PCR have the following sequences:
    or TGGAGATTTGATCCTGGCTCAG (SEQ ID No. 2), or a homologous sequence; Y
    or CCGTCAATTCCTTTGAGTTT (SEQ ID No.3), or a homologous sequence.
    25
    The method according to any one of the preceding claims, wherein the pair of primers that is used in the second PCR comprise at least the following sequences:
    or CCACT AATT ATTTT CATAT AACCAAC (SEQ ID No. 1), or a homologous sequence that differs by no more than 5 nucleotide substitutions; Y
    or GGGTT GAT AGGTT AAGAGCTGATT AAC (SEQ ID No. 4), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    6. A PCR primer comprising the following nucleotide sequence:
    CCACTAATTATTTTCATATAACCAAC (SEQ ID No. 1), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    7. Use of the primer described in any one of claims 5 or 6 in a PCR 5 for the detection of a pathogenic bacterium, which is Legionella pneumophila.
    8. The use of the preceding claim, wherein the PCR is a second nested PCR in a detection method comprising two amplification PCR of the bacterial 16S rRNA gene.
    10
    9. A kit for the detection of a pathogenic bacterium comprising a plurality of primers for PCR, one of these primers being a primer comprising at least the following sequence:
    CCACT AATT ATTTT CATAT AACCAAC (SEQ ID No. 1), or a homologous sequence that differs by no more than 5 nucleotide substitutions.
    类似技术:
    公开号 | 公开日 | 专利标题
    Schulz et al.2014|Detection of respiratory viruses and Bordetella bronchiseptica in dogs with acute respiratory tract infections
    Tang et al.2008|An effective method for isolation of DNA from pig faeces and comparison of five different methods
    Djadid et al.2009|A simple and rapid nested polymerase chain reaction–restriction fragment length polymorphism technique for differentiation of pathogenic and nonpathogenic Leptospira spp.
    Deng et al.2016|Distribution of bacteria in inhalable particles and its implications for health risks in kindergarten children in Hong Kong
    CN104862406A|2015-08-26|Primer and probe for on-site rapid detection of mycobacterium tuberculosis complex and kit thereof
    Bedir et al.2010|Simultaneous detection and differentiation of pathogenic and nonpathogenic Leptospira spp. by multiplex real-time PCR | assay
    Savoye et al.2000|A PCR assay used to study aerosol transmission of Actinobacillus pleuropneumoniae from samples of live pigs under experimental conditions
    Sánchez-Parra et al.2019|Preventing legionellosis outbreaks by a quick detection of airborne Legionella pneumophila
    Benga et al.2012|Analysis of 16S–23S rRNA internal transcribed spacer regions in Pasteurellaceae isolated from laboratory rodents
    ES2702117B2|2021-03-04|METHOD OF PCR DETECTION OF BACTERIA Legionella pneumophila IN ENVIRONMENTAL AND / OR CLINICAL SAMPLES
    RU2360971C1|2009-07-10|Method and test system to detect dna of african swine fever virus by means of specific oligonucleotide primers in polymerase chain reaction
    Posuwan et al.2010|Prevalence of respiratory viruses isolated from dogs in Thailand during 2008-2009
    CN105483211B|2018-11-06|A kind of reagent of the detection legionella pneumophilia of external shell type ring mediated isothermal amplification method and the method for detecting legionella pneumophilia
    US20150031038A1|2015-01-29|Sample preparation methods
    Grespan et al.2012|Virulence and molecular aspects of Bordetella avium isolated from cockatiel chicks | in Brazil
    JP4806749B2|2011-11-02|Bordetella pertussis gene detection method using LAMP method and primer set used in this method
    Gonzalez Pedraza et al.2014|Microbiological Isolation of Salmonella spp. And Molecular tools for detection
    Afshar et al.2008|An evaluation of PCR methods to detect strains of Mycoplasma fermentans
    CN110669852A|2020-01-10|Kit for detecting high-toxicity non-mucus Klebsiella pneumoniae
    Brindha et al.2012|Molecular characterization and identification of unknown bacteria from waste water
    Ejaz et al.2015|Molecular study on the prevalence of respiratory mycoplasma species in small ruminants of Kuchlak, District Quetta and Khanozai, District Pishin, Balochistan
    Arzola et al.2008|Duplex polymerase chain reaction as a rapid, effective diagnostic test for bovine brucellosis using blood samples.
    Neder et al.2019|First report of Mycoplasma leachii isolation associated with disease in dairy calves in Argentina
    Declerck et al.2003|PCR as a test for the presence or absence of Legionella in | water
    Gahan et al.2019|Bacillus species at the Canberra Airport: A comparison of real-time polymerase chain reaction and massively parallel sequencing for identification
    同族专利:
    公开号 | 公开日
    ES2702117B2|2021-03-04|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US5571674A|1989-09-18|1996-11-05|The Trustees Of Columbia University In The City Of New York|DNA oligomers for use in detection of campylobacter pylori and methods of using such DNA oligomers|
    US20070042422A1|1999-12-23|2007-02-22|Roche Diagnostics Corporation|Oligonucleotides for rapidly identifying microbial DNA or RNA|
    ES2395798A1|2011-07-04|2013-02-15|Universidad De Zaragoza|Method of detection of cyanobacteria and pathogenic bacteria present in water or in free-living amoebas. |
    法律状态:
    2019-02-27| BA2A| Patent application published|Ref document number: 2702117 Country of ref document: ES Kind code of ref document: A1 Effective date: 20190227 |
    2021-03-04| FG2A| Definitive protection|Ref document number: 2702117 Country of ref document: ES Kind code of ref document: B2 Effective date: 20210304 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201830830A|ES2702117B2|2018-08-16|2018-08-16|METHOD OF PCR DETECTION OF BACTERIA Legionella pneumophila IN ENVIRONMENTAL AND / OR CLINICAL SAMPLES|ES201830830A| ES2702117B2|2018-08-16|2018-08-16|METHOD OF PCR DETECTION OF BACTERIA Legionella pneumophila IN ENVIRONMENTAL AND / OR CLINICAL SAMPLES|
    [返回顶部]